Gene Name | tRNA isopentenyltransferase 1 | Gene Symbol | Trit1 | |||
Chromosome | 4 | Genomic Location | chr4:122,693,000-122,734,000 | |||
Synonyms | 2310075G14Rik, MOD5, IPT, IPPT, AI314189, AI314635, AV099619 | |||||
Links |
UCSC Genome Browser(chr4:122,693,000-122,734,000) NCBI Gene(66966) IGTC(Trit1,3946) UNIGene(Mm.475055) |
MGI(1914216) KEGG GENES(mmu:66966) EST Profile(mm.475055) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB462433 | GSS Location | chr4:122,693,840-122,694,026 | Size | 187 |
Sequence | AGATGCCTTCAAGATGGCGGCTGCGGCTGCTGCACGAGCAGTTCCTGTGAGCTCTGGATTCCGAG GCCTGCGGCGAACACTGCCACTTGTAGTGATTCTCGGGGCTACTGGGACTGGCAAGTCCACCCTG GCTCTGCAGTTAGGCCAGCGGCTCGGCGGCGAGATCGTCAGCGCCGACTCCATGCAG |
||||
Links |
UCSC Browser(chr4:122,693,840-122,694,026) IGTC(Ayu21-W154) |
[AK003556] Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110007O17 product:TRNA ISOPENTENYLPYROPHOSPHATE TRANSFERASE homolog [Homo sapiens], full insert sequence. |
Card ID | 1219 | ||||
Strain Name | B6;CB-Trit1Gt(pU-21W)154Card | ||||
Internal Code | Ayu21-W154 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Trit1) |