ID 21-W155
Registered: 2008.10.04 Last update: 2008.10.04
| Gene Name | proteasome (prosome, macropain) subunit, alpha type 3 | Gene Symbol | Psma3 | |||
| Chromosome | 12 | Genomic Location | chr12:72,075,000-72,097,000 |  |
||
| Synonyms | Lmpc8 | |||||
| Links |
UCSC Genome Browser(chr12:72,075,000-72,097,000) NCBI Gene(19167) IGTC(Psma3,539) UNIGene(Mm.296338) |
MGI(104883) KEGG GENES(mmu:19167) EST Profile(mm.296338) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB462434 | GSS Location | chr12:72,084,304-72,084,429 | Size | 126 |
| Sequence | AGTACAGCTATTGGGATCAGATGTAAAGATGGTGTTGTGTTTGGGGTAGAAAAACTAGTCCTTTC TAAACTTTATGAAGAAGGCTCCAATAAACGTCTTTTTAATGTTGATCGACATGTTGGAATG |
||||
| Links |
UCSC Browser(chr12:72,084,304-72,084,429) IGTC(Ayu21-W155) |
||||
Homology Search Results
| [AK168495] Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920028E07 product:proteasome (prosome, macropain) subunit, alpha type 3, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Psma3) |
||||