Gene Name | rho/rac guanine nucleotide exchange factor (GEF) 2 | Gene Symbol | Arhgef2 | |||
Chromosome | 3 | Genomic Location | chr3:88,419,000-88,453,000 | ![]() |
||
Synonyms | GEFH1, GEF-H1, Lbcl1, Lfc, LFP40, mKIAA0651, P40, GEF, AA408978 | |||||
Links |
UCSC Genome Browser(chr3:88,419,000-88,453,000) NCBI Gene(16800) IGTC(Arhgef2,10489) UNIGene(Mm.239329) |
MGI(103264) KEGG GENES(mmu:16800) EST Profile(mm.239329) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB477134 | GSS Location | chr3:88,425,156-88,425,243 | Size | 88 |
Sequence | GTCCTCCCGCGGCTCACGCTGGATTATGTCTCGGATCGAATCCCTCACTCGCGCGCGGATCGACC GGAGCAAGGAGCAGGCAACCAAG |
||||
Links |
UCSC Browser(chr3:88,425,156-88,425,243) IGTC(Ayu21-W158) |
[BC006589] Mus musculus rho/rac guanine nucleotide exchange factor (GEF) 2, mRNA (cDNA clone MGC:6026 IMAGE:3587800), complete cds. |
Card ID | 1265 | ||||
Strain Name | B6;CB-Arhgef2Gt(pU-21W)158Card | ||||
Internal Code | Ayu21-W158 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Arhgef2) |