ID 21-W167
Registered: 2009.01.19 Last update: 2018.06.15
| Gene Name | rabaptin, RAB GTPase binding effector protein 1 | Gene Symbol | Rabep1 | |||
| Chromosome | 11 | Genomic Location | chr11:70,657,000-70,758,000 |  |
||
| Synonyms | neurocrescin, RAB5 effector protein, rabaptin-5, Rab5ep;rabaptin-5alpha | |||||
| Links |
UCSC Genome Browser(chr11:70,657,000-70,758,000) NCBI Gene(54189) IGTC(Rabep1,633) UNIGene(Mm.7087) |
MGI(1860236) KEGG GENES(mmu:54189) EST Profile(mm.7087) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB477132 | GSS Location | chr11:70,658,435-70,658,510 | Size | 76 |
| Sequence | GCTTCCCCGCCCATCCCCGTTCTCCGAGGCCGCCCACTGGCCATGGCGCAGCCGGGCCCGGCTCC CCAGCCTGACG |
||||
| Links |
UCSC Browser(chr11:70,658,435-70,658,510) IGTC(Ayu21-W167) |
||||
Homology Search Results
| [D86066] Mus musculus mRNA for rabaptin-5, complete cds. |
Mouse Information
| Card ID | 1367 | ||||
| Strain Name | B6;CB-Rabep1Gt(pU-21W)167Card | ||||
| Internal Code | Ayu21-W167 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rabep1) |
||||