ID 21-W17
Registered: 2008.04.24 Last update: 2018.06.16
| Gene Name | Trafficjing protein, kinesin binding 1 | Gene Symbol | Trak1 | |||
| Chromosome | 9 | Genomic Location | chr9:121,200,000-121,390,000 |  |
||
| Synonyms | 2310001H13Rik, hyrt, nm1952, AI413908; AI467545; mKIAA1042 | |||||
| Links |
UCSC Genome Browser(chr9:121,200,000-121,390,000) NCBI Gene(67095) IGTC(Trak1,5403) UNIGene(Mm.305318) |
MGI(1914345) KEGG GENES(mmu:67095) EST Profile(mm.305318) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T72, 21-W127 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB435087 | GSS Location | chr9:121,300,977-121,301,169 | Size | 192 |
| Sequence | GTGTGCAACAGCACCAACCTTCCAGAAGTTGAGATCATTAGCCTGCTGGAGGAACAGCTGCCCCA TTACAAGCTAAGAGCGGACACCATCTATGGTTACGACCACGATGACTGGCTGCATACGCCCCTCA TCTCCCCAGATGCCAACATCGACCTCACAACTGAGCAGATCGAAGAGACGCTGAAATATTCC |
||||
| Links |
UCSC Browser(chr9:121,300,977-121,301,169) IGTC() |
||||
Homology Search Results
| [AK122426] Mus musculus mRNA for mKIAA1042 protein. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Trak1) |
||||