ID 21-W171
Registered: 2008.10.24 Last update: 2018.06.16
| Gene Name | WW, C2 and coiled-coil domain containing 1 | Gene Symbol | Wwc1 | |||
| Chromosome | 11 | Genomic Location | chr11:35,650,000-35,795,000 |  |
||
| Synonyms | Kibra, MGC:47054, AA408228, AU017197, BC037006, mKIAA0869 | |||||
| Links |
UCSC Genome Browser(chr11:35,650,000-35,795,000) NCBI Gene(211652) IGTC(Wwc1,15829) UNIGene(Mm.31267) |
MGI(2388637) KEGG GENES(mmu:211652) EST Profile(mm.31267) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB466335 | GSS Location | chr11:35,793,473-35,793,623 | Size | 168 |
| Sequence | GTGGCAATGCAAGCTTGCATGGGGGAGCGGCGGGCCAGGCTCGGGAAGATGCCCCGCGCCGGAGT TGCCCCTGCCGGAGGGCTGGGAGGAGGCGCGCGACTTCGACGGCAAGGTCTACTACATAGATCAC AGGAACCGCACCACCAGCTGGATCGACCCGCGGGACAG |
||||
| Links |
UCSC Browser(chr11:35,793,473-35,793,623) IGTC(Ayu21-W171) |
||||
Homology Search Results
| [AK220259] Mus musculus mRNA for mKIAA0869 protein. |
Mouse Information
| Card ID | 1272 | ||||
| Strain Name | B6;CB-Wwc1Gt(pU-21W)171Card | ||||
| Internal Code | Ayu21-W171 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Wwc1) |
||||