Gene Name | WW, C2 and coiled-coil domain containing 1 | Gene Symbol | Wwc1 | |||
Chromosome | 11 | Genomic Location | chr11:35,650,000-35,795,000 | ![]() |
||
Synonyms | Kibra, MGC:47054, AA408228, AU017197, BC037006, mKIAA0869 | |||||
Links |
UCSC Genome Browser(chr11:35,650,000-35,795,000) NCBI Gene(211652) IGTC(Wwc1,15829) UNIGene(Mm.31267) |
MGI(2388637) KEGG GENES(mmu:211652) EST Profile(mm.31267) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB466335 | GSS Location | chr11:35,793,473-35,793,623 | Size | 168 |
Sequence | GTGGCAATGCAAGCTTGCATGGGGGAGCGGCGGGCCAGGCTCGGGAAGATGCCCCGCGCCGGAGT TGCCCCTGCCGGAGGGCTGGGAGGAGGCGCGCGACTTCGACGGCAAGGTCTACTACATAGATCAC AGGAACCGCACCACCAGCTGGATCGACCCGCGGGACAG |
||||
Links |
UCSC Browser(chr11:35,793,473-35,793,623) IGTC(Ayu21-W171) |
[AK220259] Mus musculus mRNA for mKIAA0869 protein. |
Card ID | 1272 | ||||
Strain Name | B6;CB-Wwc1Gt(pU-21W)171Card | ||||
Internal Code | Ayu21-W171 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Wwc1) |