ID 21-W173
Registered: 2008.10.24 Last update: 2018.06.16
| Gene Name | zinc finger protein 444 | Gene Symbol | Zfp444 | |||
| Chromosome | 7 | Genomic Location | chr7:6,123,000-6,144,000 |  |
||
| Synonyms | 2810031J10Rik, 6230401O10Rik, mFLJ00134 | |||||
| Links |
UCSC Genome Browser(chr7:6,123,000-6,144,000) NCBI Gene(72667) IGTC(Zfp444,14252) UNIGene(Mm.274089) |
MGI(1923365) KEGG GENES(mmu:72667) EST Profile(mm.274089) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB466336 | GSS Location | chr7:6,124,114-6,124,176 | Size | 63 |
| Sequence | TGAGCTTTGTGCGCATGTGCGGGAAGGTGAGGTTGTTTGGGGGGCCTCGCCCAGGAGAGTGAG | ||||
| Links |
UCSC Browser(chr7:6,124,114-6,124,176) IGTC(Ayu21-W173) |
||||
Homology Search Results
| [AK169973] Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630006D22 product:WEAKLY similar to zinc finger protein 165 homolog, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Zfp444) |
||||