ID 21-W174
Registered: 2008.10.24 Last update: 2018.06.16
| Gene Name | COP9 signalosome subunit 4 | Gene Symbol | Cops4 | |||
| Chromosome | 5 | Genomic Location | chr5:100,946,000-100,978,000 |  |
||
| Synonyms | COP9 complex S4, D5Ertd774e, SGN4; AW208976 | |||||
| Links |
UCSC Genome Browser(chr5:100,946,000-100,978,000) NCBI Gene(26891) IGTC(Cops4,227) UNIGene(Mm.957) |
MGI(1349414) KEGG GENES(mmu:26891) EST Profile(mm.957) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB466337 | GSS Location | chr5:100,947,443-100,947,569 | Size | 127 |
| Sequence | GTTTTCTTCTTGGCAGCGAGAGGTCCCGCAGCCGTGGCTGAGCTGGAGGAAAGATGGCGGCTGCC GTGCGACAGGATTTGGCCCAGCTCATGAATTCAAGCGGCTCTCATAAAGATCTGGCGGGCAA |
||||
| Links |
UCSC Browser(chr5:100,947,443-100,947,569) IGTC(Ayu21-W174) |
||||
Homology Search Results
| [AK167833] AK167833 1611 bp mRNA linear HTC 19-SEP-2008 DEFINITION Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched library, clone:I730032A20 product:COP9 (constitutive photomorphogenic) homolog, subunit 4 (Arabidopsis thaliana), full insert sequence. |
Mouse Information
| Card ID | 1254 | ||||
| Strain Name | B6;CB-Cops4Gt(pU-21W)174Card | ||||
| Internal Code | Ayu21-W174 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Cops4) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |