ID 21-W18
Registered: 2008.06.18 Last update: 2018.06.16
| Gene Name | ubiquitin protein ligase E3C | Gene Symbol | Ube3c | |||
| Chromosome | 5 | Genomic Location | chr5:29,895,000-30,005,000 |  |
||
| Synonyms | mKIAA0010, AI853514 | |||||
| Links |
UCSC Genome Browser(chr5:29,895,000-30,005,000) NCBI Gene(100763) IGTC(Ube3c,5315) UNIGene(Mm.137746) |
MGI(2140998) KEGG GENES(mmu:100763) EST Profile(mm.137746) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB441710 | GSS Location | chr5:29,895,852-29,896,120 | Size | 269 |
| Sequence | TGTGGATAAATAAGCAGCGGGGACAGGCCGGCCTCCAGCGTCGCCGCGCTCGCGCCCGCGTGCAG GGCGGAGAGCGCTGAGCCTCGGGGGGGGCGGCGCGGGACAGCGAGGCCGCGACCCTGCCGGGCCC CGCCCAGCCCGCCGGGCCCGCCCCCGGCCGCTCCGCTGCCTGCCGGGCCGCGCAGATGGGATAAG CGGCGAAGATGTTCAGCTTCGAAGGCGACTTCAAGACAAGGCCCAAAGTGTCTCTCGGTGGCGCG AGCAGGAAG |
||||
| Links |
UCSC Browser(chr5:29,895,852-29,896,120) IGTC(Ayu21-W18) |
||||
Homology Search Results
| [AK046056] Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length enriched library, clone:B230339B05 product:hypothetical HECT domain (Ubiquitin-protein ligase) containing protein, full insert sequence. |
Mouse Information
| Card ID | 1242 | ||||
| Strain Name | B6;CB-Ube3cGt(pU-21W)18Card | ||||
| Internal Code | Ayu21-W18 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Ube3c) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |