Gene Name | RIKEN cDNA 1110038B12 gene | Gene Symbol | 1110038B12Rik | |||
Chromosome | 17 | Genomic Location | chr17:35,087,000-35,089,500 | |||
Synonyms | 0610009C20Rik, 0910001G04Rik | |||||
Links |
UCSC Genome Browser(chr17:35,087,000-35,089,500) NCBI Gene(68763) IGTC(1110038B12Rik,913) UNIGene(Mm.28895) |
MGI(1916013) KEGG GENES(mmu:) EST Profile(mm.28895) |
Other Clone Trapped This Gene |
---|
21-W26, 21-B141 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB504281 | GSS Location | chr17:35,089,297-35,089,407 | Size | 112 |
Sequence | GTGCACCCGCCCACACGGTTTGCCGTGTTTTCACCCTTCTTTGTTCTCCACCGGTTCTGGGCAGG GTCTGAGGACTCCGGAGAGCAAGGCATGGGTCCGCCTCGTGCCGCAG |
||||
Links |
UCSC Browser(chr17:35,089,297-35,089,407) IGTC(Ayu21-W188) |
[AK004150] Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110038B12 product:unclassifiable, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for 1110038B12Rik) |