ID 21-W191
Registered: 2009.04.01 Last update: 2011.02.25
| Gene Name | calcium binding protein 39-like | Gene Symbol | Cab39l | |||
| Chromosome | 14 | Genomic Location | chr14:60,058,000-60,174,000 |  |
||
| Synonyms | MO2L, AA589432, 1500031K13Rik, 2810425O13Rik, 4930520C08Rik | |||||
| Links |
UCSC Genome Browser(chr14:60,058,000-60,174,000) NCBI Gene(69008) IGTC(Cab39l,4356) UNIGene(Mm.179091) |
MGI(1914081) KEGG GENES(mmu:69008) EST Profile(mm.179091) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB494458 | GSS Location | chr14:60,059,822-60,059,855 | Size | 34 |
| Sequence | CGCTGGAGTGGTGGCGCAGCGCTCTCTGCCCGCG | ||||
| Links |
UCSC Browser(chr14:60,059,822-60,059,855) IGTC(Ayu21-W191) |
||||
Homology Search Results
| [NM_026908] Mus musculus calcium binding protein 39-like (Cab39l), mRNA. |
Mouse Information
| Card ID | 1292 | ||||
| Strain Name | B6;CB-Cab39lGt(pU-21W)191Card | ||||
| Internal Code | Ayu21-W191 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Cab39l) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |