ID 21-W193
Registered: 2009.05.22 Last update: 2010.07.06
| Gene Name | septin 9 | Gene Symbol | Sept9 | |||
| Chromosome | 11 | Genomic Location | chr11:117,055,000-117,230,000 |  |
||
| Synonyms | Msf, MSF1, Sint1, SL3-3 integration site 1, PNUTL4 | |||||
| Links |
UCSC Genome Browser(chr11:117,055,000-117,230,000) NCBI Gene(53860) IGTC(Sept9,5720) UNIGene(Mm.38450) |
MGI(1858222) KEGG GENES(mmu:53860) EST Profile(mm.38450) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB504282 | GSS Location | chr11:117,169,492-117,169,585 | Size | 95 |
| Sequence | GGAGATGCAGCAGAGCAAGGCCCCACACAATCCACTGTATCACCGACCACCCTGATTTCAGGAAA CCCAGCCCCCAGGGCTCCTCACGGCCCCAG |
||||
| Links |
UCSC Browser(chr11:117,169,492-117,169,585) IGTC(Ayu21-W193) |
||||
Homology Search Results
| [BY199699] BY199699 RIKEN full-length enriched, B6-derived CD11 +ve dendritic cells Mus musculus cDNA clone F730045F01 5', mRNA sequence. |
Mouse Information
| Card ID | 1307 | ||||
| Strain Name | B6;CB-Sept9Gt(pU-21W)193Card | ||||
| Internal Code | Ayu21-W193 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Sept9) |
||||