ID 21-W196
Registered: 2009.04.01 Last update: 2010.09.17
| Gene Name | ribosomal protein L30 | Gene Symbol | Rpl30 | |||
| Chromosome | 15 | Genomic Location | chr15:34,370,200-34,373,100 |  |
||
| Synonyms | MGC106425, MGC107559 | |||||
| Links |
UCSC Genome Browser(chr15:34,370,200-34,373,100) NCBI Gene(19946) IGTC(Rpl30,192) UNIGene(Mm.439801) |
MGI(98037) KEGG GENES(mmu:19946) EST Profile(mm.439801) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB494461 | GSS Location | chr15:34,370,987-34,372,977 | Size | 368 |
| Sequence | CCTTTCTCGCTCCCCGGCCATCTTGGCGGCTGGTGTTGGTTGGGGGTTGTCCCGCACCTAAGGCA GGAAGATGGTGGCCGCAAAGAAGACGAAAAAGTCTCTGGAGTCGATCAACTCTAGGCTCCAACTT GTTATGAAAAGTGGGAAGTACGTGCTGGGCTACAAGCAGACTCTGAAGATGATCAGACAAGGCAA AGCGAAGTTGGTTATCCTTGCCAACAACTGTCCAGCTTTGAGGAAATCTGAAATAGAGTACTATG CCATGTTGGCTAAAACTGGGGTCCATCACTACAGTGGCAATAATATTGAACTGGGCACAGCGTGT GGAAAATACTACAGAGTATGCACACTGGCTATCATTGACCCAG |
||||
| Links |
UCSC Browser(chr15:34,370,987-34,372,977) IGTC(Ayu21-W196) |
||||
Homology Search Results
| [BC100608] Mus musculus ribosomal protein L30, mRNA (cDNA clone MGC:118727 IMAGE:6753186), complete cds. |
Mouse Information
| Card ID | 1308 | ||||
| Strain Name | B6;CB-Rpl30Gt(pU-21W)196Card | ||||
| Internal Code | Ayu21-W196 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rpl30) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |