ID 21-W202
Registered: 2009.04.01 Last update: 2009.12.14
| Gene Name | transketolase | Gene Symbol | Tkt | |||
| Chromosome | 14 | Genomic Location | chr14:31,362,000-31,388,500 |  |
||
| Synonyms | p68 | |||||
| Links |
UCSC Genome Browser(chr14:31,362,000-31,388,500) NCBI Gene(21881) IGTC(Tkt,4176) UNIGene(Mm.290692) |
MGI(105992) KEGG GENES(mmu:21881) EST Profile(mm.290692) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB494466 | GSS Location | chr14:31,362,364-31,362,566 | Size | 203 |
| Sequence | CCTCGGTCACTGCTGGTCGCTTCCTGAGCCGCTGCTGGCTCTGTGTCTCTGTCCTCAGCGTTCTC GTCCTCGTCCTCGTCCTCGTCCTACCACGCCATGGAAGGTTACCATAAGCCAGATCAGCAGAAGC TCCAGGCCCTGAAGGACACAGCCAATCGCCTGCGCATCAGCTCCATCCAGGCCACCACCGCGGCA GGCTCAGG |
||||
| Links |
UCSC Browser(chr14:31,362,364-31,362,566) IGTC(Ayu21-W202) |
||||
Homology Search Results
| [NM_009388] Mus musculus transketolase (Tkt), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Tkt) |
||||