ID 21-W205
Registered: 2009.04.06 Last update: 2011.01.14
| Gene Name | stromal antigen 1 | Gene Symbol | Stag1 | |||
| Chromosome | 9 | Genomic Location | chr9:100,540,000-100,870,000 |  |
||
| Synonyms | Scc3, SA-1, AU045003 | |||||
| Links |
UCSC Genome Browser(chr9:100,540,000-100,870,000) NCBI Gene(20842) IGTC(Stag1,8089) UNIGene(Mm.42135) |
MGI(1098658) KEGG GENES(mmu:20842) EST Profile(mm.42135) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W201 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB495077 | GSS Location | chr9:100,544,035-100,544,215 | Size | 181 |
| Sequence | GGCGTGTGGAAAATGCCACCAGATGGCGGGTTAGGATTGCAGCTCCGTTGAAGGCGCGGCCCCCG CTCCCGAACCCCCGGCGACCACCCCGTAACCACCCCCCCACCTCGGGAATAACACACCGGAGACT TTTGGGGGGAAACTAGGTCGACGGCCGACAGCGCCCGGATGGGCAGCTGAG |
||||
| Links |
UCSC Browser(chr9:100,544,035-100,544,215) IGTC(Ayu21-W205) |
||||
Homology Search Results
| [BC062954] Mus musculus stromal antigen 1, mRNA (cDNA clone MGC:86167 IMAGE:30537388), complete cds. |
Mouse Information
| Card ID | 1531 | ||||
| Strain Name | B6;CB-Stag1Gt(pU-21W)205Card | ||||
| Internal Code | Ayu21-W205 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Stag1) |
||||
Expression Information
| Description | |
|---|---|
| Image | Male Female |