ID 21-W209
Registered: 2009.04.06 Last update: 2018.06.18
| Gene Name | protease (prosome, macropain) 26S subunit, ATPase 1 | Gene Symbol | Psmc1 | |||
| Chromosome | 12 | Genomic Location | chr12:101,348,000-101,362,000 |  |
||
| Synonyms | P26s4, rpt2, Rpt2/S4, S4, P26s4, AI325227 | |||||
| Links |
UCSC Genome Browser(chr12:101,348,000-101,362,000) NCBI Gene(19179) IGTC(Psmc1,11826) UNIGene(Mm.157105) |
MGI(106054) KEGG GENES(mmu:19179) EST Profile(mm.157105) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB495080 | GSS Location | chr12:101,348,387-101,348,421 | Size | 35 |
| Sequence | CCGGCGGTGGCGATTTGGAGGACTGAAGGAAGATG | ||||
| Links |
UCSC Browser(chr12:101,348,387-101,348,421) IGTC(Ayu21-W209) |
||||
Homology Search Results
| [AK161723] Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5830416M11 product:protease (prosome, macropain) 26S subunit, ATPase 1, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Psmc1) |
||||