Gene Name | sprouty RTK signaling antagonist 4 | Gene Symbol | Spry4 | |||
Chromosome | 18 | Genomic Location | chr18:38,745,000-38,762,000 | |||
Synonyms | sprouty4, A030006O18Rik | |||||
Links |
UCSC Genome Browser(chr18:38,745,000-38,762,000) NCBI Gene(24066) IGTC(Spry4,804) UNIGene(Mm.42038) |
MGI(1345144) KEGG GENES(mmu:24066) EST Profile(mm.42038) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB504284 | GSS Location | chr18:38,760,824-38,760,994 | Size | 171 |
Sequence | CGCCGCTGAGGCAGCGAACAGAGCTGACAGCGCGGAGCTGGCGCTGCAGGGCTCAGGGAGCTTTG CCGGCTCCTCCGACTGACGTCTGCGACTTCAACGGCGACTGACCCACTCGGGTTCGGGGATTTAC ACAGACGTGGAGCGATGCTTGTGACTCTGCAGCTCCTCAAA |
||||
Links |
UCSC Browser(chr18:38,760,824-38,760,994) IGTC(Ayu21-W211) |
[AK089363] Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F730015G14 product:unclassifiable, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Spry4) |