ID 21-W218
Registered: 2009.04.06 Last update: 2018.08.29
| Gene Name | SURP and G patch domain containing 2 | Gene Symbol | Sugp2 | |||
| Chromosome | 8 | Genomic Location | chr8:72,757,000-72,789,000 |  |
||
| Synonyms | MGC66544, mKIAA0365, Sfrs14, Srsf14 | |||||
| Links |
UCSC Genome Browser(chr8:72,757,000-72,789,000) NCBI Gene(234373) IGTC(Sugp2,4429) UNIGene(Mm.284505) |
MGI(2678085) KEGG GENES(mmu:234373) EST Profile(mm.284505) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB495087 | GSS Location | chr8:72,760,568-72,760,693 | Size | 126 |
| Sequence | AAAAAAAAAAAACCATGGCAGCAAGGCGGATGGCGCAGGAATCTTTGGACAGTGTATTACAGGAG AAATCTAAACGGTATGGGGATTCCGAAGCTGTTGGTGAAGCTCTCCATCTTAAAGCTCAAG |
||||
| Links |
UCSC Browser(chr8:72,760,568-72,760,693) IGTC(Ayu21-W218) |
||||
Homology Search Results
| [AK042293] Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630079E18 product:hypothetical D111/G-patch domain/Aminoacyl-transfer RNA synthetases class-I/Glutamic acid-rich region/SWAP / SURP containing protein, full insert sequence. |
Mouse Information
| Card ID | 1459 | ||||
| Strain Name | B6;CB-Sfrs14Gt(pU-21W)218Card | ||||
| Internal Code | Ayu21-W218 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Sugp2) |
||||