ID 21-W222
Registered: 2009.04.06 Last update: 2011.10.17
| Gene Name | pyruvate kinase, muscle | Gene Symbol | Pkm2 | |||
| Chromosome | 9 | Genomic Location | chr9:59,504,000-59,528,000 |  |
||
| Synonyms | Pk3, Pk-2, Pk-3, AA414905, AL024370, AL024424 | |||||
| Links |
UCSC Genome Browser(chr9:59,504,000-59,528,000) NCBI Gene(18746) IGTC(Pkm2,1055) UNIGene(Mm.326167) |
MGI(97591) KEGG GENES(mmu:18746) EST Profile(mm.326167) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB495090 | GSS Location | chr9:59,504,383-59,504,456 | Size | 74 |
| Sequence | GCACAGCAGCGACTCGTCTTCACTTGACTGACGTCCGCTCTAGGTATCGCAGCAGGAACCGAAGT ACGCCCGAG |
||||
| Links |
UCSC Browser(chr9:59,504,383-59,504,456) IGTC(Ayu21-W222) |
||||
Homology Search Results
| [AK168943] Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920066L02 product:pyruvate kinase, muscle, full insert sequence. |
Mouse Information
| Card ID | 1741 | ||||
| Strain Name | B6;CB-Pkm2Gt(pU-21W)222Card | ||||
| Internal Code | Ayu21-W222 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Pkm2) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |