ID 21-W224
Registered: 2009.05.22 Last update: 2018.08.29
| Gene Name | CREB3 regulatory factor | Gene Symbol | Crebrf | |||
| Chromosome | 17 | Genomic Location | chr17:26,852,000-26,912,000 |  |
||
| Synonyms | A930001N09Rik, RP23-478C2.1 | |||||
| Links |
UCSC Genome Browser(chr17:26,852,000-26,912,000) NCBI Gene(77128) IGTC(Crebrf,9850) UNIGene(Mm.275414) |
MGI(1924378) KEGG GENES(mmu:77128) EST Profile(mm.275414) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB504285 | GSS Location | chr17:26,852,602-26,852,719 | Size | 118 |
| Sequence | GCGATTTCCGGGAACCCGTCAGGAAGGACATAAACAAAACAAACCGAGGCAGCATGGAGACGGCC CGCGGCCGCGTAAGCGCGGCCGGATCCAGTGCCTGAACCGCCTTCAGCCTCAG |
||||
| Links |
UCSC Browser(chr17:26,852,602-26,852,719) IGTC(Ayu21-W224) |
||||
Homology Search Results
| [AK030092] Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932441F15 product:hypothetical protein, full insert sequence. |
Mouse Information
| Card ID | 1310 | ||||
| Strain Name | B6;CB-A930001N09RikGt(pU-21W)224Card | ||||
| Internal Code | Ayu21-W224 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Crebrf) |
||||