ID 21-W227
Registered: 2009.05.22 Last update: 2018.08.29
| Gene Name | WD repeat and coiled coil containing | Gene Symbol | Wdcp | |||
| Chromosome | 12 | Genomic Location | chr12:4,850,000-4,864,000 |  |
||
| Synonyms | BC068281, A430092C04 | |||||
| Links |
UCSC Genome Browser(chr12:4,850,000-4,864,000) NCBI Gene(238037) IGTC(Wdcp,15914) UNIGene(Mm.146087) |
MGI(3040699) KEGG GENES(mmu:238037) EST Profile(mm.146087) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB504288 | GSS Location | chr12:4,850,145-4,850,257 | Size | 113 |
| Sequence | CCGAGTTCCAAAGGCCGAGGCTTCCGTTAGGTGCCCGGGACTTCTGATTCCCGGTCCTGTGACGT GAGCGGCCCCGGGATTTTACGTGTGGGACGGGGAGGCAGAAGACTAAG |
||||
| Links |
UCSC Browser(chr12:4,850,145-4,850,257) IGTC(Ayu21-W227) |
||||
Homology Search Results
| [AK163398] Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library, clone:B020033D21 product:unclassifiable, full insert sequence. |
Mouse Information
| Card ID | 1312 | ||||
| Strain Name | B6;CB-WdcpGt(pU-21W)227Card | ||||
| Internal Code | Ayu21-W227 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Wdcp) |
||||