ID 21-W229
Registered: 2009.05.22 Last update: 2010.09.17
| Gene Name | UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5 | Gene Symbol | B4galt5 | |||
| Chromosome | 2 | Genomic Location | chr2:167,122,000-167,175,500 |  |
||
| Synonyms | AW049941, AW539721, 9430078I07Rik | |||||
| Links |
UCSC Genome Browser(chr2:167,122,000-167,175,500) NCBI Gene(56336) IGTC(B4galt5,15848) UNIGene(Mm.200886) |
MGI(1927169) KEGG GENES(mmu:56336) EST Profile(mm.200886) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB504289 | GSS Location | chr2:167,174,418-167,174,678 | Size | 261 |
| Sequence | ATGTGGCCCGGCCCGCGGCGGCCGGCGGCTGAAAGCGGCGAGGCGGCGGCGCGCGAAGCCCGGAA GGCGGCGGCCGAGGCCCAGGCGGCGGACCGGAGCGGCGGGAGCGGGGCCCGGGTTGGCCCTCGAG CGGCCGCCGGCTCAGCATGCGCGCCCGCCGGGGGCTGCTGCGGCTGCCGCGCCGCTCGCTGCTCG CCGCGCTCTTCTTCTTCTCGCTGTCGTCCTCGCTGCTCTACTTCGTCTATGTGGCGCCCGGCATA G |
||||
| Links |
UCSC Browser(chr2:167,174,418-167,174,678) IGTC(Ayu21-W229) |
||||
Homology Search Results
| [NM_019835] Mus musculus UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5 (B4galt5), mRNA. |
Mouse Information
| Card ID | 1313 | ||||
| Strain Name | B6;CB-B4galt5Gt(pU-21W)229Card | ||||
| Internal Code | Ayu21-W229 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for B4galt5) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |