ID 21-W233
Registered: 2009.05.23 Last update: 2009.12.25
| Gene Name | CLIP associating protein 1 | Gene Symbol | Clasp1 | |||
| Chromosome | 1 | Genomic Location | chr1:120,284,000-120,510,000 |  |
||
| Synonyms | KIAA0622, mKIAA0622, 1700030C23Rik, 5730583A19Rik, B130045P17Rik | |||||
| Links |
UCSC Genome Browser(chr1:120,284,000-120,510,000) NCBI Gene(76707) IGTC(Clasp1,1648) UNIGene(Mm.138740) |
MGI(1923957) KEGG GENES(mmu:76707) EST Profile(mm.138740) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB504293 | GSS Location | chr1:120,286,007-120,286,098 | Size | 92 |
| Sequence | AATCCCCGCACCAAGCGCTTAACCTCATTGGGGTGGAGGAGAAGGCGGTGGCTGTCCGGTCCGCA GCCGCAACAGTAGTGAATAATAGAACT |
||||
| Links |
UCSC Browser(chr1:120,286,007-120,286,098) IGTC(Ayu21-W233) |
||||
Homology Search Results
| [AK042402] Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630089D04 product:similar to CLASP1 (FRAGMENT) [Mus musculus], full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Clasp1) |
||||