ID 21-W24
Registered: 2008.03.28 Last update: 2018.08.31
| Gene Name | NEDD4 binding protein 2-like 2 | Gene Symbol | N4bp2l2 | |||
| Chromosome | 5 | Genomic Location | chr5:151,437,000-151,469,000 |  |
||
| Synonyms | 2700092H06Rik, MGC:25830, zag1, Gm38758 | |||||
| Links |
UCSC Genome Browser(chr5:151,437,000-151,469,000) NCBI Gene(381695) IGTC(N4bp2l2,28867) UNIGene(Mm.246934) |
MGI(2687207) KEGG GENES(mmu:381695) EST Profile(mm.246934) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB430398 | GSS Location | chr5:151,468,076-151,468,141 | Size | 67 |
| Sequence | GAGCCTCGCGTCTCTTTCCAGCTCCGTTTAATAGCTACGTTTTGGACGGTCTCTCGTCTTCCCGG AG |
||||
| Links |
UCSC Browser(chr5:151,468,076-151,468,141) IGTC(Ayu21-W24) |
||||
Homology Search Results
| [BC037393] Mus musculus cDNA sequence BC037393, mRNA (cDNA clone MGC:25830 IMAGE:4167971), complete cds. |
Mouse Information
| Card ID | 1302 | ||||
| Strain Name | B6;CB-N4bp2l2Gt(pU-21W)24Card | ||||
| Internal Code | Ayu21-W24 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for N4bp2l2) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |