Gene Name | dephospho-CoA kinase domain containing | Gene Symbol | Dcakd | |||
Chromosome | 11 | Genomic Location | chr11:102,855,000-102,879,000 | ![]() |
||
Synonyms | AI849483, FLJ22955, RP23-463E7.9, 3010024O21Rik, 6720485C15Rik | |||||
Links |
UCSC Genome Browser(chr11:102,855,000-102,879,000) NCBI Gene(68087) IGTC(Dcakd,606) UNIGene(Mm.277449) |
MGI(1915337) KEGG GENES(mmu:68087) EST Profile(mm.277449) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB510927 | GSS Location | chr11:102,878,364-102,878,441 | Size | 78 |
Sequence | CCTGTGTGCAGCGAGCCAGCCAGTAAGCGCAGCGGAGATTGGGCTAGCGACGGAGGCTGAGGCCG AGTCGGAGACCCG |
||||
Links |
UCSC Browser(chr11:102,878,364-102,878,441) IGTC(Ayu21-W244) |
[AK051022] Mus musculus 9 days embryo whole body cDNA, RIKEN full-length enriched library, clone:D030055P10 product:weakly similar to DEPHOSPHO-COA KINASE (EC 2.7.1.24) (DEPHOSPHOCOENZYME A KINASE) [Bacillus subtilis], full insert sequence. |
Card ID | 1464 | ||||
Strain Name | B6;CB-DcakdGt(pU-21W)244Card | ||||
Internal Code | Ayu21-W244 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Dcakd) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |