ID 21-W244
Registered: 2009.07.01 Last update: 2010.09.17
| Gene Name | dephospho-CoA kinase domain containing | Gene Symbol | Dcakd | |||
| Chromosome | 11 | Genomic Location | chr11:102,855,000-102,879,000 |  |
||
| Synonyms | AI849483, FLJ22955, RP23-463E7.9, 3010024O21Rik, 6720485C15Rik | |||||
| Links |
UCSC Genome Browser(chr11:102,855,000-102,879,000) NCBI Gene(68087) IGTC(Dcakd,606) UNIGene(Mm.277449) |
MGI(1915337) KEGG GENES(mmu:68087) EST Profile(mm.277449) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB510927 | GSS Location | chr11:102,878,364-102,878,441 | Size | 78 |
| Sequence | CCTGTGTGCAGCGAGCCAGCCAGTAAGCGCAGCGGAGATTGGGCTAGCGACGGAGGCTGAGGCCG AGTCGGAGACCCG |
||||
| Links |
UCSC Browser(chr11:102,878,364-102,878,441) IGTC(Ayu21-W244) |
||||
Homology Search Results
| [AK051022] Mus musculus 9 days embryo whole body cDNA, RIKEN full-length enriched library, clone:D030055P10 product:weakly similar to DEPHOSPHO-COA KINASE (EC 2.7.1.24) (DEPHOSPHOCOENZYME A KINASE) [Bacillus subtilis], full insert sequence. |
Mouse Information
| Card ID | 1464 | ||||
| Strain Name | B6;CB-DcakdGt(pU-21W)244Card | ||||
| Internal Code | Ayu21-W244 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Dcakd) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |