ID 21-W246
Registered: 2009.03.26 Last update: 2018.08.31
| Gene Name | argonaute RISC catalytic subunit 1 | Gene Symbol | Ago1 | |||
| Chromosome | 4 | Genomic Location | chr4:126,116,000-126,147,000 |  |
||
| Synonyms | argonaute 1, Eif2c1 | |||||
| Links |
UCSC Genome Browser(chr4:126,116,000-126,147,000) NCBI Gene(236511) IGTC(Ago1,4404) UNIGene(Mm.30800) |
MGI(2446630) KEGG GENES(mmu:236511) EST Profile(mm.30800) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB491937 | GSS Location | chr4:126,145,641-126,145,869 | Size | 229 |
| Sequence | TACTCGGGCGCTAGCAGGGGGAGCTGCTGCAGGCTCCGCGGCGGCGGCAACGGAGGCTGCGGGGG CGACAGCGCGAGCGGCCGGGCTTCGGGGGGGAGCCGAGCCCGGCCCGGGAGCCCGAGCAGTGCAA GTGCGAGGTACCTAGGCCCCTCACGCTGGACTCCTCAGTCTCCCGGCCGCCTGTCCTCCGCACGG GTATATGGGATGGAAGCGGGACCCTCGGGAGCAG |
||||
| Links |
UCSC Browser(chr4:126,145,641-126,145,869) IGTC(Ayu21-W246) |
||||
Homology Search Results
| [NM_153403] Mus musculus eukaryotic translation initiation factor 2C, 1 (Eif2c1), mRNA. |
Mouse Information
| Card ID | 1290 | ||||
| Strain Name | B6;CB-Ago1Gt(pU-21W)246Card | ||||
| Internal Code | Ayu21-W246 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Ago1) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |