Gene Name | argonaute RISC catalytic subunit 1 | Gene Symbol | Ago1 | |||
Chromosome | 4 | Genomic Location | chr4:126,116,000-126,147,000 | ![]() |
||
Synonyms | argonaute 1, Eif2c1 | |||||
Links |
UCSC Genome Browser(chr4:126,116,000-126,147,000) NCBI Gene(236511) IGTC(Ago1,4404) UNIGene(Mm.30800) |
MGI(2446630) KEGG GENES(mmu:236511) EST Profile(mm.30800) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB491937 | GSS Location | chr4:126,145,641-126,145,869 | Size | 229 |
Sequence | TACTCGGGCGCTAGCAGGGGGAGCTGCTGCAGGCTCCGCGGCGGCGGCAACGGAGGCTGCGGGGG CGACAGCGCGAGCGGCCGGGCTTCGGGGGGGAGCCGAGCCCGGCCCGGGAGCCCGAGCAGTGCAA GTGCGAGGTACCTAGGCCCCTCACGCTGGACTCCTCAGTCTCCCGGCCGCCTGTCCTCCGCACGG GTATATGGGATGGAAGCGGGACCCTCGGGAGCAG |
||||
Links |
UCSC Browser(chr4:126,145,641-126,145,869) IGTC(Ayu21-W246) |
[NM_153403] Mus musculus eukaryotic translation initiation factor 2C, 1 (Eif2c1), mRNA. |
Card ID | 1290 | ||||
Strain Name | B6;CB-Ago1Gt(pU-21W)246Card | ||||
Internal Code | Ayu21-W246 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Ago1) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |