Gene Name | nuclear transcription factor-Y beta | Gene Symbol | Nfyb | |||
Chromosome | 10 | Genomic Location | chr10:82,211,000-82,227,500 | |||
Synonyms | Cbf-A, AA985999 | |||||
Links |
UCSC Genome Browser(chr10:82,211,000-82,227,500) NCBI Gene(18045) IGTC(Nfyb,5738) UNIGene(Mm.245998) |
MGI(97317) KEGG GENES(mmu:18045) EST Profile(mm.245998) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB491938 | GSS Location | chr10:82,224,578-82,226,884 | Size | 217 |
Sequence | AAGCGGCCCGCGGCGGAGGGAGGGGAGGCCGAGTCCTGGAAGTGGAGCTCCGCGCTGGGACTGGT TCCTTCGCAGCCATTTTCTGTCCAACCAAACAGCCGATTGGAGACGGGAGCCAACCAGGGCTGCA TTGGAGGTTAAAATTATACAAGGATCCACCACCTTTTTGACAGGTATTTGAGAATACCACTGATA CACAATACAGTATTTCATGACA |
||||
Links |
UCSC Browser(chr10:82,224,578-82,226,884) IGTC(Ayu21-W247) |
[AK146168] Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730027J03 product:nuclear transcription factor-Y beta, full insert sequence. |
Card ID | 1314 | ||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Nfyb) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |