ID 21-W249
Registered: 2009.03.26 Last update: 2009.12.07
| Gene Name | discs large MAGUK scaffold protein 3 | Gene Symbol | Dlg3 | |||
| Chromosome | X | Genomic Location | chrX:97,962,000-98,015,000 |  |
||
| Synonyms | Dlgh3, DLG3, SAP102, mKIAA1232 | |||||
| Links |
UCSC Genome Browser(chrX:97,962,000-98,015,000) NCBI Gene(53310) IGTC(Dlg3,23506) UNIGene(Mm.4615) |
MGI(1888986) KEGG GENES(mmu:53310) EST Profile(mm.4615) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB491940 | GSS Location | chrX:97,972,619-97,992,139 | Size | 208 |
| Sequence | GCTTTGTGTCCGTGGTCTCCCGCGCGGGACAGAGGGACCGGCCGGAGCCGGCGCTTTCTCGACAA CTAGACCTGGACTCCGACTGAGCGCCAGAGTACAGTCGCTTTGAATCCAAGATCCATGACTTGCG GGAACAAATGATGAACAGCAGCATGAGTTCTGGGTCTGGGTCTCTCCGAACCAGTGAGAAGAGGT CCTTGTATGTCAG |
||||
| Links |
UCSC Browser(chrX:97,972,619-97,992,139) IGTC(Ayu21-W249) |
||||
Homology Search Results
| [AK159655] Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420027E20 product:discs, large homolog 3 (Drosophila), full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Dlg3) |
||||