ID 21-W25
Registered: 2008.06.18 Last update: 2018.09.05
| Gene Name | ligand dependent nuclear receptor corepressor | Gene Symbol | Lcor | |||
| Chromosome | 19 | Genomic Location | chr19:41,556,000-41,638,000 |  |
||
| Synonyms | Mlr2, 3110023F06Rik, A630025C20Rik, mKIAA1795 | |||||
| Links |
UCSC Genome Browser(chr19:41,556,000-41,638,000) NCBI Gene(212391) IGTC(Lcor,2290) UNIGene(Mm.422910) |
MGI(2443930) KEGG GENES(mmu:212391) EST Profile(mm.422910) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB441711 | GSS Location | chr19:41,602,522-41,603,130 | Size | 135 |
| Sequence | ATTCTTGAAGGGCTGTTTGGACCTGCGTTATTAAAAGATCTCAGTTTATTTAAAGAGTGTGACCC TGAAAGCATTTCTGATTGGGCGTTTGATGAAAATTGTCTGTTCTGTTGCTTGAAAAGAGATAAAG TAAAG |
||||
| Links |
UCSC Browser(chr19:41,602,522-41,603,130) IGTC(Ayu21-W25) |
||||
Homology Search Results
| [AK155007] Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630115K23 product:Mblk1-related protein-2, full insert sequence. |
Mouse Information
| Card ID | 1199 | ||||
| Strain Name | B6;CB-LcorGt(pU-21W)25Card | ||||
| Internal Code | Ayu21-W25 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Lcor) |
||||