ID 21-W251
Registered: 2009.05.23 Last update: 2011.03.25
| Gene Name | nudix (nucleoside diphosphate linked moiety X)-type motif 4 | Gene Symbol | Nudt4 | |||
| Chromosome | 10 | Genomic Location | chr10:95,009,000-95,027,500 |  |
||
| Synonyms | DIPP2, DIPP2alpha, HDCMB47P, DIPP2beta, 4933436C10Rik | |||||
| Links |
UCSC Genome Browser(chr10:95,009,000-95,027,500) NCBI Gene(71207) IGTC(Nudt4,3210) UNIGene(Mm.24397) |
MGI(1918457) KEGG GENES(mmu:71207) EST Profile(mm.24397) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB504295 | GSS Location | chr10:95,026,296-95,026,512 | Size | 217 |
| Sequence | CGCCCGTCCCACCGGCGCCCGAGCATCGCGACTTCCTTCGGCCCGACTCCCCGGCGGGGTGGCGG CGGCCGGGTCCCCACGGTGGCGGCCGGAGCAGCGGCTGCAGGAGCCCGGCTCTAGGATGAAGTTC AAGCCCAACCAGACGCGGACGTACGACCGCGAGGGCTTCAAGAAGAGGGCGGCCTGCCTGTGCTT CCGCAGCGAGCAGGAGGACGAG |
||||
| Links |
UCSC Browser(chr10:95,026,296-95,026,512) IGTC(Ayu21-W251) |
||||
Homology Search Results
| [NM_027722] Mus musculus nudix (nucleoside diphosphate linked moiety X)-type motif 4 (Nudt4), mRNA. |
Mouse Information
| Card ID | 1530 | ||||
| Strain Name | B6;CB-Nudt4Gt(pU-21W)251Card | ||||
| Internal Code | Ayu21-W251 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA).Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Nudt4) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |