| Gene Name | armadillo repeat containing 9 | Gene Symbol | Armc9 | |||
| Chromosome | 1 | Genomic Location | chr1:88,050,000-88,178,000 | |||
| Synonyms | 3830422A13Rik, 4831423D23Rik, 4930438O05Rik, 5730415N24Rik | |||||
| Links |
UCSC Genome Browser(chr1:88,050,000-88,178,000) NCBI Gene(78795) IGTC(Armc9,9313) UNIGene(Mm.379264) |
MGI(1926045) KEGG GENES(mmu:78795) EST Profile(mm.379264) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB504297 | GSS Location | chr1:88,051,359-88,051,418 | Size | 61 |
| Sequence | GGCCCGGGTGACGGCCGGCGAGCTGGCGGTCTGGAGGAGTGAGCGCAGAGCCCTGCAGCAG | ||||
| Links |
UCSC Browser(chr1:88,051,359-88,051,418) IGTC(Ayu21-W255) |
||||
| [AK164041] Mus musculus 7 days embryo whole body cDNA, RIKEN full-length enriched library, clone:C430026L04 product:ARM protein homolog [Homo sapiens], full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Armc9) |
||||