Gene Name | RIKEN cDNA 1110059E24 gene | Gene Symbol | 1110059E24Rik | |||
Chromosome | 19 | Genomic Location | chr19:21,670,000-21,728,000 | ![]() |
||
Synonyms | ||||||
Links |
UCSC Genome Browser(chr19:21,670,000-21,728,000) NCBI Gene(66206) IGTC(1110059E24Rik,5920) UNIGene(Mm.272430) |
MGI(1913456) KEGG GENES(mmu:66206) EST Profile(mm.272430) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB491942 | GSS Location | chr19:21,727,097-21,727,297 | Size | 202 |
Sequence | CCGGGTCACTGTCCTTAGTCTCAATCTGGGGCGGGAACGTCTTTACTCTTTNCCTGTAACTTAAA GGCTGCACCGATTTACAGTGCTTGAGATTTTGGTGATGAGTTCCCAGAAAGGCAACGTGACTCGG TCCCGGCCTCAGAAGCACCAGAATACGTTCACCTTCAAAAATGACAAGTTTGATAAGAGTGTTCA GACCAAG |
||||
Links |
UCSC Browser(chr19:21,727,097-21,727,297) IGTC(Ayu21-W256) |
[AK016266] Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930570K09 product:weakly similar to CDNA FLJ32509 FIS, CLONE SMINT1000054 [Homo sapiens], full insert sequence. |
Card ID | 1315 | ||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for 1110059E24Rik) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |