ID 21-W257
Registered: 2009.03.26 Last update: 2009.12.07
| Gene Name | core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) | Gene Symbol | Cbfa2t2 | |||
| Chromosome | 2 | Genomic Location | chr2:154,260,000-154,370,000 |  |
||
| Synonyms | MTGR1, Cbfa2t2h, A430091M07, C330013D05Rik | |||||
| Links |
UCSC Genome Browser(chr2:154,260,000-154,370,000) NCBI Gene(12396) IGTC(Cbfa2t2,1253) UNIGene(Mm.29914) |
MGI(1333833) KEGG GENES(mmu:12396) EST Profile(mm.29914) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W4, 21-MT42 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB491943 | GSS Location | chr2:154,262,196-154,262,372 | Size | 178 |
| Sequence | GCGCGGCCTAACGGCGGCGGCGGCAGCGGCGGCGGCGGCGCTGGTGCGGGCGAGTTCGGCGGGTG CAGGTACCCGGCCTGCGCCTGCGGAGGGCTCAGGCAGAGGGTCGAAGCGAGCGGCGCTCGCGACA GACTGCGCTCCGCGATGGTGGGCGTCCCTGGAGCGGCCGCCTTCCAAC |
||||
| Links |
UCSC Browser(chr2:154,262,196-154,262,372) IGTC(Ayu21-W257) |
||||
Homology Search Results
| [BC064679] Mus musculus core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human), mRNA (cDNA clone MGC:67347 IMAGE:6405896), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Cbfa2t2) |
||||