Gene Name | testis expressed gene 2 | Gene Symbol | Tex2 | |||
Chromosome | 11 | Genomic Location | chr11:106,360,000-106,480,000 | ![]() |
||
Synonyms | Def-5, Taz4, AI553404, 4930568E07Rik, mKIAA1738 | |||||
Links |
UCSC Genome Browser(chr11:106,360,000-106,480,000) NCBI Gene(21763) IGTC(Tex2,6960) UNIGene(Mm.102407) |
MGI(102465) KEGG GENES(mmu:21763) EST Profile(mm.102407) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB505803 | GSS Location | chr11:106,474,172-106,474,746 | Size | 217 |
Sequence | CCAGTTTCTGGAACTAGCAGGGATTGATAAAGTCCGACGTCCTCCTAAGACCTCTGTTCCTAAGA ATCTGCCTAGCCAGACAGTTTGGTGCCCGGGGGCGGGCGGGCAGCAGCACGGCGGCCCCAGCCAG AGCCGGAGCCGGAGCTGGAGCAGGAGCCGCGGCGGCCGCCAAGTACGGGCGCCGGTGTAGTAGGA TGAGGCAGCCAGCGGATCCGGG |
||||
Links |
UCSC Browser(chr11:106,474,172-106,474,746) IGTC(Ayu21-W265) |
[NM_198292] Mus musculus testis expressed gene 2 (Tex2), mRNA. |
Card ID | 1465 | ||||
Strain Name | B6;CB-Tex2Gt(pU-21W)265Card | ||||
Internal Code | Ayu21-W265 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Tex2) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |