ID 21-W270
Registered: 2009.07.01 Last update: 2010.09.17
| Gene Name | polymerase (RNA) II (DNA directed) polypeptide J | Gene Symbol | Polr2j | |||
| Chromosome | 5 | Genomic Location | chr5:136,592,500-136,599,000 |  |
||
| Synonyms | Rpb11a, Rpo2-4, 14.5kDa, RNA polymerase II subunit RPB14, Polr2i | |||||
| Links |
UCSC Genome Browser(chr5:136,592,500-136,599,000) NCBI Gene(20022) IGTC(Polr2j,3663) UNIGene(Mm.4896) |
MGI(109582) KEGG GENES(mmu:20022) EST Profile(mm.4896) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB510930 | GSS Location | chr5:136,592,569-136,595,954 | Size | 198 |
| Sequence | GGTTGGCGGAAGGAGACTGTGGGTTGGTGTCGGGGAGCGAGAGCGCGGCGCTAGGATGAACGCTC CTCCGGCCTTCGAGTCGTTCTTGCTCTTCGAGGGCGAGAAGAAAATCACCATTAACAAGGACACT AAGGTTCCCAACGCCTGCTTGTTCACCATCAACAAAGAAGACCACACTCTGGGGAACATCATTAA ATC |
||||
| Links |
UCSC Browser(chr5:136,592,569-136,595,954) IGTC(Ayu21-W270) |
||||
Homology Search Results
| [AK158610] Mus musculus visual cortex cDNA, RIKEN full-length enriched library, clone:K230026J18 product:polymerase (RNA) II (DNA directed) polypeptide J, full insert sequence. |
Mouse Information
| Card ID | 1529 | ||||
| Strain Name | B6;CB-Polr2jGt(pU-21W)270Card | ||||
| Internal Code | Ayu21-W270 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Polr2j) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |