Gene Name | catenin (cadherin associated protein), beta 1 | Gene Symbol | Ctnnb1 | |||
Chromosome | 9 | Genomic Location | chr9:120,842,000-120,870,000 | |||
Synonyms | Catnb, beta catenin, beta-catenin, Mesc, Bfc | |||||
Links |
UCSC Genome Browser(chr9:120,842,000-120,870,000) NCBI Gene(12387) IGTC(Ctnnb1,14014) UNIGene(Mm.291928) |
MGI(88276) KEGG GENES(mmu:12387) EST Profile(mm.291928) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB510931 | GSS Location | chr9:120,842,606-120,842,756 | Size | 151 |
Sequence | AAGCCCTCGCTCGGTGGCGGCCGCGTCAGCTCGTGTCCTGTGAAGCCCGCGGCCCGGGGAGGCGG AGACGGAGCACGGTGGGCGCCGAGCCGTCAGTGCAGGAGGCCGAGGCCGAGCGGGCGGCCGCGAG TGAGCAGCGCGCGGGCCTGAG |
||||
Links |
UCSC Browser(chr9:120,842,606-120,842,756) IGTC(Ayu21-W271) |
[BC053065] Mus musculus catenin (cadherin associated protein), beta 1, mRNA (cDNA clone MGC:62386 IMAGE:5709247), complete cds. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Ctnnb1) |