ID 21-W276
Registered: 2009.07.01 Last update: 2018.09.05
| Gene Name | potassium channel tetramerisation domain containing 10 | Gene Symbol | Kctd10 | |||
| Chromosome | 5 | Genomic Location | chr5:114,813,000-114,831,000 |  |
||
| Synonyms | C87062, AW536343, MGC11654, mBACURD3 | |||||
| Links |
UCSC Genome Browser(chr5:114,813,000-114,831,000) NCBI Gene(330171) IGTC(Kctd10,10039) UNIGene(Mm.238285) |
MGI(2141207) KEGG GENES(mmu:330171) EST Profile(mm.238285) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB510933 | GSS Location | chr5:114,830,435-114,830,512 | Size | 78 |
| Sequence | CCCCTGCATTGAGCGAGCTGGGTGTTTCCTGCCTCTCAGTCCGGATTTGGAGACTCCGGCGTCCT CCGACTTTTCATG |
||||
| Links |
UCSC Browser(chr5:114,830,435-114,830,512) IGTC(Ayu21-W276) |
||||
Homology Search Results
| [NM_001159941] Mus musculus potassium channel tetramerisation domain containing 10 (Kctd10), transcript variant 1, mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Kctd10) |
||||