ID 21-W28
Registered: 2008.10.26 Last update: 2012.04.28
| Gene Name | tet methylcytosine dioxygenase 1 | Gene Symbol | Tet1 | |||
| Chromosome | 10 | Genomic Location | chr10:62,263,000-62,345,000 |  |
||
| Synonyms | LCX, Cxxc6, AA517754, BB001228, mKIAA1676, D10Ertd17e, 2510010B09Rik | |||||
| Links |
UCSC Genome Browser(chr10:62,263,000-62,345,000) NCBI Gene(52463) IGTC(Tet1,4107) UNIGene(Mm.17774) |
MGI(1098693) KEGG GENES(mmu:52463) EST Profile(mm.17774) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB467271 | GSS Location | chr10:62,327,556-62,327,999 | Size | 170 |
| Sequence | TGCAGAAGCAGGCAAGATGGCTACCTCGTGGGCTTCGCCGTGAAGAATGCAGAAGCTAATTAAGA CAGACTTTTAGGGGGAAAGGGGGCATTTCCCTCCATCTTTATTTATGCAAGGTTACAAAAGAAAA CAAGAGGCCCCAGAGGGAAAAGAAGCCCAAAGTTTTAAAG |
||||
| Links |
UCSC Browser(chr10:62,327,556-62,327,999) IGTC(Ayu21-W28) |
||||
Homology Search Results
| [AK129421] Mus musculus mRNA for mKIAA1676 protein. |
Mouse Information
| Card ID | 1291 | ||||
| Strain Name | B6;CB-<i>Tet1<sup>Gt(pU-21W)28Card</sup></i> | ||||
| Internal Code | Ayu21-W28 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Tet1) |
||||