ID 21-W282
Registered: 2009.06.01 Last update: 2011.03.25
| Gene Name | ADP-ribosylation factor 3 | Gene Symbol | Arf3 | |||
| Chromosome | 15 | Genomic Location | chr15:98,567,000-98,594,000 |  |
||
| Synonyms | AI854770, 5430400P17Rik | |||||
| Links |
UCSC Genome Browser(chr15:98,567,000-98,594,000) NCBI Gene(11842) IGTC(Arf3,23021) UNIGene(Mm.221298) |
MGI(99432) KEGG GENES(mmu:11842) EST Profile(mm.221298) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-MT52 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB505809 | GSS Location | chr15:98,593,411-98,593,605 | Size | 195 |
| Sequence | GCACAGCTCCTGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGCGGGCAGGAGGGAGCCGGGG AGCGGGCCAGCGGACCATCTTCACCGCGGTCGGGTCGGCTTGCGGAGCGGGAGGCAGCGGCCGGA GAGCCGGGCGGAACCTGCGGGGGCGGAGGCGGCGGTGGCAGCCGCGGCGCAGGGAGCAGGAACAG |
||||
| Links |
UCSC Browser(chr15:98,593,411-98,593,605) IGTC(Ayu21-W282) |
||||
Homology Search Results
| [NM_007478] Mus musculus ADP-ribosylation factor 3 (Arf3), mRNA. |
Mouse Information
| Card ID | 1589 | ||||
| Strain Name | B6;CB-Arf3Gt(pU-21W)282Card | ||||
| Internal Code | Ayu21-W282 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Arf3) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |