ID 21-W298
Registered: 2009.07.01 Last update: 2010.07.06
| Gene Name | CDC42 effector protein (Rho GTPase binding) 4 | Gene Symbol | Cdc42ep4 | |||
| Chromosome | 11 | Genomic Location | chr11:113,587,000-113,615,000 |  |
||
| Synonyms | CEP4, Borg4, 1500041M20Rik | |||||
| Links |
UCSC Genome Browser(chr11:113,587,000-113,615,000) NCBI Gene(56699) IGTC(Cdc42ep4,11839) UNIGene(Mm.293378) |
MGI(1929760) KEGG GENES(mmu:56699) EST Profile(mm.293378) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB510939 | GSS Location | chr11:113,590,882-113,613,138 | Size | 235 |
| Sequence | AGCACACTCGGAGCCCCGGGAGCCAGAGGAAACAAACGCCGGCGCTGCCATGGGTCGCCAGCCTT GCCGAGGCGCCAAGCACACCGAGGGGAGCGTACAGCCGCACCTGGTCCGCGCTCGGGGAGCTGGG GACCGAGCCCTCTGATTGCCCTGTCTACCCTTTGCATTGCTGGACTTCAGATCTGACCCCATACC TGCCTGTTGCCTTGGGAGTGCCCAGCTCCCCCGCAGCCAG |
||||
| Links |
UCSC Browser(chr11:113,590,882-113,613,138) IGTC(Ayu21-W298) |
||||
Homology Search Results
| [NM_020006] Mus musculus CDC42 effector protein (Rho GTPase binding) 4 (Cdc42ep4), mRNA. |
Mouse Information
| Card ID | 1586 | ||||
| Strain Name | B6;CB-Cdc42ep4Gt(pU-21W)298Card | ||||
| Internal Code | Ayu21-W298 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Trap vector was inserted in the second exon of Cdc42ep4 gene, just before start codon. Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Cdc42ep4) |
||||