ID 21-W303
Registered: 2009.06.16 Last update: 2018.09.05
| Gene Name | parvin, beta | Gene Symbol | Parvb | |||
| Chromosome | 15 | Genomic Location | chr15:84,060,000-84,148,000 |  |
||
| Synonyms | D15Gsk1, AI595373; AW742462, affixin | |||||
| Links |
UCSC Genome Browser(chr15:84,060,000-84,148,000) NCBI Gene(170736) IGTC(Parvb,3884) UNIGene(Mm.323892) |
MGI(2153063) KEGG GENES(mmu:170736) EST Profile(mm.323892) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB508943 | GSS Location | chr15:84,062,492-84,103,999 | Size | 286 |
| Sequence | GCACTCGCTTATGTCCTCCGCGCCACCACGGTCGCCCACCCCGCGGGCCCCCAAGATGAAGAAGG ACGAGTCTTTCTTGGGCAAGTTGGGCGGCACACTGGCAAGGAAGAAGAAGACCAGGGAGGTGACT GACTTACAGGAAGAAGGCAAGAGCGCCATCAACTCTCCAATGGCCCCGGCTTTGGTGGACATTCA CCCTGAAGACACCCAGCTAGAGGAGAATGAGGAGCGTACCATGATCGATCCCACCTCTAGAGAAG ACCCCAAGTTCAAGGAGTTGGTCAAG |
||||
| Links |
UCSC Browser(chr15:84,062,492-84,103,999) IGTC(Ayu21-W303) |
||||
Homology Search Results
| [NM_133167] Mus musculus parvin, beta (Parvb), mRNA. |
Mouse Information
| Card ID | 1620 | ||||
| Strain Name | B6;CB-ParvbGt(pU-21W)303Card | ||||
| Internal Code | Ayu21-W303 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Parvb) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |