Gene Name | histone PARylation factor 1 | Gene Symbol | Hpf1 | |||
Chromosome | 8 | Genomic Location | chr8:63,369,000-63,387,000 | |||
Synonyms | C230006B22Rik, 2700029M09Rik, C4orf27 | |||||
Links |
UCSC Genome Browser(chr8:63,369,000-63,387,000) NCBI Gene(72612) IGTC(Hpf1,14134) UNIGene(Mm.25263) |
MGI(1919862) KEGG GENES(mmu:72612) EST Profile(mm.25263) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB514150 | GSS Location | chr8:63,369,247-63,369,333 | Size | 87 |
Sequence | CAGGAGCGCGGGCCTTGGCTCGCTCGCTGCGGCTGCGGGATGGTTGGCGGTGGCGGGAAGCGCCG GACGGCCGGGGCGGGACCGCAG |
||||
Links |
UCSC Browser(chr8:63,369,247-63,369,333) IGTC(Ayu21-W312) |
[NM_028299] Mus musculus RIKEN cDNA 2700029M09 gene (2700029M09Rik), mRNA. |
Card ID | 1674 | ||||
Strain Name | B6;CB-2700029M09RikGt(pU-21W)312Card | ||||
Internal Code | Ayu21-W312 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Hpf1) |