ID 21-W315
Registered: 2009.06.16 Last update: 2011.03.25
| Gene Name | retinoic acid induced 14 | Gene Symbol | Rai14 | |||
| Chromosome | 15 | Genomic Location | chr15:10,495,000-10,648,000 |  |
||
| Synonyms | Norpeg, mKIAA1334, Ankycorbin, 1700008J19Rik, 1700020L11Rik | |||||
| Links |
UCSC Genome Browser(chr15:10,495,000-10,648,000) NCBI Gene(75646) IGTC(Rai14,5900) UNIGene(Mm.212395) |
MGI(1922896) KEGG GENES(mmu:75646) EST Profile(mm.212395) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB508946 | GSS Location | chr15:10,620,126-10,644,406 | Size | 211 |
| Sequence | GGAGGAGGAGGAGGAGGGACCCAGCGCAGGAAGCCGAGCAGGAAGCGAGCCCGGCAGCCGCACTT TCCTGGGGAAGCGGCGGGCGGGACGGCCAGCGGGGCCAGGAGCTGAGGCCGCCGCTTGGATGGGG TATTGACAAATCTCCCAGGACTTTGGAAGGCTGAATGGACTAAACATGAAGAGCCTGAAAGCAAA GTTTCGGAAGAGCGAT |
||||
| Links |
UCSC Browser(chr15:10,620,126-10,644,406) IGTC(Ayu21-W315) |
||||
Homology Search Results
| [NM_030690] Mus musculus retinoic acid induced 14 (Rai14), mRNA. |
Mouse Information
| Card ID | 1677 | ||||
| Strain Name | B6;CB-Rai14Gt(pU-21W)315Card | ||||
| Internal Code | Ayu21-W315 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rai14) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |