Gene Name | retinoic acid induced 14 | Gene Symbol | Rai14 | |||
Chromosome | 15 | Genomic Location | chr15:10,495,000-10,648,000 | ![]() |
||
Synonyms | Norpeg, mKIAA1334, Ankycorbin, 1700008J19Rik, 1700020L11Rik | |||||
Links |
UCSC Genome Browser(chr15:10,495,000-10,648,000) NCBI Gene(75646) IGTC(Rai14,5900) UNIGene(Mm.212395) |
MGI(1922896) KEGG GENES(mmu:75646) EST Profile(mm.212395) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB508946 | GSS Location | chr15:10,620,126-10,644,406 | Size | 211 |
Sequence | GGAGGAGGAGGAGGAGGGACCCAGCGCAGGAAGCCGAGCAGGAAGCGAGCCCGGCAGCCGCACTT TCCTGGGGAAGCGGCGGGCGGGACGGCCAGCGGGGCCAGGAGCTGAGGCCGCCGCTTGGATGGGG TATTGACAAATCTCCCAGGACTTTGGAAGGCTGAATGGACTAAACATGAAGAGCCTGAAAGCAAA GTTTCGGAAGAGCGAT |
||||
Links |
UCSC Browser(chr15:10,620,126-10,644,406) IGTC(Ayu21-W315) |
[NM_030690] Mus musculus retinoic acid induced 14 (Rai14), mRNA. |
Card ID | 1677 | ||||
Strain Name | B6;CB-Rai14Gt(pU-21W)315Card | ||||
Internal Code | Ayu21-W315 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Rai14) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |