Gene Name | Williams-Beuren syndrome chromosome region 16 homolog (human) | Gene Symbol | Wbscr16 | |||
Chromosome | 5 | Genomic Location | chr5:134,623,000-134,653,000 | |||
Synonyms | 5730496C04Rik, AU019812 | |||||
Links |
UCSC Genome Browser(chr5:134,623,000-134,653,000) NCBI Gene(94254) IGTC(Wbscr16,22623) UNIGene(Mm.29508) |
MGI(2137600) KEGG GENES(mmu:94254) EST Profile(mm.29508) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB550826 | GSS Location | chr5:134,647,709-134,652,321 | Size | 190 |
Sequence | GCCCCGACGCAGGATCCAGCCGGTCCCCTACCGCCTGGAGCCGGATCATAAGATTTCCTCTGCTG CCTGTGGCTATGGATTCACATTGCTGTCCTCGAAAACCAAGGATGTTACAAAAGTCTGGGGCATG GGACTCAACAAAGATTCCCAGCTGGGATTCCACAGGAGCCGGAAGGATAAAAGTAAGCAG |
||||
Links |
UCSC Browser(chr5:134,647,709-134,652,321) IGTC(Ayu21-W333) |
[NM_033572] Mus musculus Williams-Beuren syndrome chromosome region 16 homolog (human) (Wbscr16), mRNA. |
Card ID | 1744 | ||||
Strain Name | B6;CB-Wbscr16Gt(pU-21W)333Card | ||||
Internal Code | Ayu21-W333 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Wbscr16) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |