ID 21-W339
Registered: 2010.03.24 Last update: 2015.10.22
| Gene Name | functional intergenic repeating RNA element | Gene Symbol | Firre | |||
| Chromosome | X | Genomic Location | chrX:47,908,000-47,990,000 |  |
||
| Synonyms | AW048145, 5830467J12Rik, 6720401G13Rik | |||||
| Links |
UCSC Genome Browser(chrX:47,908,000-47,990,000) NCBI Gene(103012) IGTC(Firre,50603) UNIGene(Mm.482523) |
MGI(2147989) KEGG GENES(mmu:) EST Profile(mm.482523) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB550827 | GSS Location | chrX:47,961,655-47,961,992 | Size | 256 |
| Sequence | GAACTGGACGATGAATTTTAACCTCCACACCACAAGCACTGGGGTAGAAGACTGCTGCTGGGTGA AGAAGAGACTAGACTTGATCATTGAGCAGCCACTCACTGATATCTTCAGTGCTGCATGAGGAAGA GTTTATTCTTCTGGATTTGGTGGTGGATTCTGGTGAAGATACAGATGGATGCTCTGGCTGAGTCG CTACCTTGAAATGAAAATGGGAGGTAAACTCTCCCATAGATGAATCTTCCTCATTTTGAAG |
||||
| Links |
UCSC Browser(chrX:47,961,655-47,961,992) IGTC(Ayu21-W339) |
||||
Homology Search Results
| [NR_015505] Mus musculus RIKEN cDNA 6720401G13 gene (6720401G13Rik), transcript variant 1, non-coding RNA. |
Mouse Information
| Card ID | 1809 | ||||
| Strain Name | B6;CB-<i>6720401G13Rik<sup>Gt(pU-21W)339Card</sup></i> | ||||
| Internal Code | Ayu21-W339 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Firre) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |