Gene Name | insulin-like growth factor 2 mRNA binding protein 2 | Gene Symbol | Igf2bp2 | |||
Chromosome | 16 | Genomic Location | chr16:22,058,000-22,154,000 | |||
Synonyms | IMP-2, Imp2, Neilsen, C330012H03Rik | |||||
Links |
UCSC Genome Browser(chr16:22,058,000-22,154,000) NCBI Gene(319765) IGTC(Igf2bp2,15542) UNIGene(Mm.294740) |
MGI(1890358) KEGG GENES(mmu:319765) EST Profile(mm.294740) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB517703 | GSS Location | chr16:22,161,319-22,162,983 | Size | 186 |
Sequence | CCTCCGGCAGCTCTTCGGGGACAGGAAGCTGCCCCTGGCGGGACAGGTCCTACTCAAGTCCGGCT ACGCCTTCGTGGACTACCCCGACCAGAACTGGGCCATCCGCGCCATCGAGACCCTCTCGGGTAAA GTGGAATTGCATGGGAAAATCATGGAAGTTGACTACTCAGTCTCTAAAAAGCTAAG |
||||
Links |
UCSC Browser(chr16:22,161,319-22,162,983) IGTC(Ayu21-W343) |
[NM_183029] Mus musculus insulin-like growth factor 2 mRNA binding protein 2 (Igf2bp2), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Igf2bp2) |