Gene Name | dynein light chain LC8-type 2 | Gene Symbol | Dynll2 | |||
Chromosome | 11 | Genomic Location | chr11:87,792,500-87,812,500 | |||
Synonyms | DLC8, Dlc2, DLC8b, C87222, 1700064A15Rik, 6720463E02Rik | |||||
Links |
UCSC Genome Browser(chr11:87,792,500-87,812,500) NCBI Gene(68097) IGTC(Dynll2,7672) UNIGene(Mm.246436) |
MGI(1915347) KEGG GENES(mmu:68097) EST Profile(mm.246436) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB517704 | GSS Location | chr11:87,794,918-87,795,074 | Size | 157 |
Sequence | AGGAATTTGACAAGAAATATAACCCTACCTGGCATTGTATCGTGGGCCGGAATTTTGGCAGCTAT GTCACACACGAGACAAAGCACTTCATCTATTTTTACTTGGGTCAAGTTGCAATCCTCCTCTTCAA GTCGGGCTAGGTGGCCGAGGCGAAGGT |
||||
Links |
UCSC Browser(chr11:87,794,918-87,795,074) IGTC(Ayu21-W344) |
[NM_026556] Mus musculus dynein light chain LC8-type 2 (Dynll2), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Trap vector was inserted in the last exon. Vector insertion point was 17 bp down stream of the stop codon of Dynll2 gene. This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Dynll2) |