ID 21-W345
Registered: 2009.10.14 Last update: 2010.01.05
| Gene Name | ELK3, member of ETS oncogene family | Gene Symbol | Elk3 | |||
| Chromosome | 10 | Genomic Location | chr10:92,709,000-92,775,000 |  |
||
| Synonyms | Erp, Net, Etrp, Sap-2, D430049E23Rik | |||||
| Links |
UCSC Genome Browser(chr10:92,709,000-92,775,000) NCBI Gene(13713) IGTC(Elk3,41960) UNIGene(Mm.4454) |
MGI(101762) KEGG GENES(mmu:13713) EST Profile(mm.4454) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | 525690 | GSS Location | chr10:92,773,497-92,773,672 | Size | 176 |
| Sequence | AAAAAAAAAAAGAGGAGCGAGAGAAAGAAAAAAAAAAGAGGGGGGAAAATCAGGATCTCATTACA AGAGCAACAGACCGTCTGCAGACGCCTGTCAGCATGGAAAGTCGGGGGCTTTCGCCCGGTTCCTC CTAGAAATCTCCCCAAGAAGACTCCCAAACGCTCCCCCACGTCTGG |
||||
| Links |
UCSC Browser(chr10:92,773,497-92,773,672) IGTC(Ayu21-W345) |
||||
Homology Search Results
| [NM_013508] Mus musculus ELK3, member of ETS oncogene family (Elk3), transcript variant 1, mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Elk3) |
||||