ID 21-W359
Registered: 2009.10.15 Last update: 2011.05.09
| Gene Name | nonhomologous end-joining factor 1 | Gene Symbol | Nhej1 | |||
| Chromosome | 1 | Genomic Location | chr1:75,010,000-75,125,000 |  |
||
| Synonyms | XLF, MGC130191, MGC130192, cernunnos, 1700029B21Rik | |||||
| Links |
UCSC Genome Browser(chr1:75,010,000-75,125,000) NCBI Gene(75570) IGTC(Nhej1,) UNIGene(Mm.439736) |
MGI(1922820) KEGG GENES(mmu:75570) EST Profile(mm.439736) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB525776 | GSS Location | chr1:75,121,710-75,121,815 | Size | 106 |
| Sequence | AGACCCCGCCTTCCTGAGTGTGTTGTGTGTGGGGGGGTGGCCTCTCAGTTTGCGCACCAGGACAG GCCCGCCTTGAGGAGGGTGGGAGTTCCCGCAGCCGTTGACG |
||||
| Links |
UCSC Browser(chr1:75,121,710-75,121,815) IGTC(Ayu21-W359) |
||||
Homology Search Results
| [NM_029342] Mus musculus nonhomologous end-joining factor 1 (Nhej1), mRNA. |
Mouse Information
| Card ID | 1737 | ||||
| Strain Name | B6;CB-Nhej1Gt(pU-21W)359Card | ||||
| Internal Code | Ayu21-W359 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Nhej1) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |