ID 21-W371
Registered: 2009.12.02 Last update: 2015.04.11
| Gene Name | angiogenin, ribonuclease, RNase A family, 5 | Gene Symbol | Ang | |||
| Chromosome | 14 | Genomic Location | chr14:51,710,500-51,726,000 |  |
||
| Synonyms | Rnase4, Ang1, Rnase5, Rnase5a, AI385586 | |||||
| Links |
UCSC Genome Browser(chr14:51,710,500-51,726,000) NCBI Gene(11727) IGTC(Ang,46773) UNIGene(Mm.202665) |
MGI(88022) KEGG GENES(mmu:11727) EST Profile(mm.202665) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB535726 | GSS Location | chr14:51,710,821-51,710,928 | Size | 108 |
| Sequence | ACCCATATCGGGGACGAGATTCCAAAGGAAATTTCATTCTTCTATTCGCCATCCCAACAGGAAGG AAGGAGTGAGAAACAAAGCTGCCGCCTCCAGTTCCGGGTCCAG |
||||
| Links |
UCSC Browser(chr14:51,710,821-51,710,928) IGTC(Ayu21-W371) |
||||
Homology Search Results
| [NM_021472] Mus musculus ribonuclease, RNase A family 4 (Rnase4), transcript variant 1, mRNA. |
| [NM_001161731] Mus musculus angiogenin, ribonuclease, RNase A family, 5 (Ang), transcript variant 2, mRNA. |
Mouse Information
| Card ID | 1693 | ||||
| Strain Name | B6;CB-AngGt(pU-21W)371Card | ||||
| Internal Code | Ayu21-W371 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Trap vector was inserted in the intron behind the common first exon of Ang and Rnase4. Mouse line has been established from this clone, and deposited to the CARD R-BASE. [Paper] "Conformational Change in Transfer RNA Is an Early Indicator of Acute Cellular Damage." Mishima, E., Inoue, C., Saigusa, D., Inoue, R., Ito, K., Suzuki, Y., Jinno, D., Tsukui, Y., Akamatsu, Y., Araki, M., Araki, K., Shimizu, R., Shinke, H., Suzuki, T., Takeuchi, Y., Shima, H., Akiyama, Y., Toyohara, T., Suzuki, C., Saiki, Y., Tominaga, T., Miyagi, S., Kawagisihi, N., Soga, T., Ohkubo, T., Yamamura, K., Imai, Y., Masuda, S., Sabbisetti, V., Ichimura, T., Mount, D. B., Bonventre, J. V., Ito, S., Tomioka, Y., Itoh, K., Abe, T., J. Am. Soc. Nephrology, 25 (10), 2316-2326 (2014). PubMed ID:24833129. |
||||
| Links |
IMSR (for Ang) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |